NR_4.0_65634.1

Members (69)
History
Heat map

#	IFE	Standardized name	Molecule	Organism	Source	Rfam	Title	Method	Res. Å	Date
1	4V9F\|1\|0 (rep)	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins	X-ray diffraction	2.4	2014-07-09
2	1S72\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION	X-ray diffraction	2.4	2004-06-15
3	1VQO\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui	X-ray diffraction	2.2	2005-11-29
4	3CC2\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins	X-ray diffraction	2.4	2008-05-20
5	1VQK\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2005-11-29
6	1VQP\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R((DC)P(DC)P(PPU)(LOF)P(PO2)PAPCC)-3'	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.25	2005-11-29
7	3CCU\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C	X-ray diffraction	2.8	2008-05-20
8	1JJ2\|1\|0	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution	X-ray diffraction	2.4	2001-08-01
9	1K73\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-ray diffraction	3.01	2003-07-22
10	1VQ6\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)(ACA)(BTN))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.7	2005-11-29
11	3CPW\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CPCPAP(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI	X-ray diffraction	2.7	2008-07-22
12	1VQM\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2005-11-29
13	3CC4\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-ray diffraction	2.7	2008-05-20
14	3G6E\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit	X-ray diffraction	2.7	2009-04-28
15	1VQ4\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(5AA)P(2OP)P(PO2)P(DA)PCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.7	2005-11-29
16	1VQ8\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(DA)(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.2	2005-11-29
17	1QVF\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3.1	2003-11-11
18	1VQL\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.3	2005-11-29
19	1M90\|1\|A	Large subunit ribosomal RNA	23S RRNA, CCA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit	X-ray diffraction	2.8	2002-09-06
20	3CCM\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U	X-ray diffraction	2.55	2008-05-20
21	1VQ9\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)*(ACA))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.4	2005-11-29
22	1YHQ\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.4	2005-04-26
23	1NJI\|1\|A	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of chloramphenicol bound to the 50S ribosomal subunit	X-ray diffraction	3	2003-07-22
24	1VQ7\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCP(5AA)P(2OP)P(PAE)PAPCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.5	2005-11-29
25	1VQN\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-R(CPCPAP(PHE)(ACA)(BTN))-3'	Haloarcula marismortui	Archaea	RF02540	The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.4	2005-11-29
26	1YI2\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.65	2005-04-26
27	3CC7\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U	X-ray diffraction	2.7	2008-05-20
28	1KQS\|1\|0	Large subunit ribosomal RNA	23S RRNA, CCA, CC-Pmn-pcb	Haloarcula marismortui	Archaea	RF02540	The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis	X-ray diffraction	3.1	2002-02-22
29	3CXC\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CPCP*A)-3'	Haloarcula marismortui	Archaea	RF02540	The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui	X-ray diffraction	3	2009-04-28
30	1KC8\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit	X-ray diffraction	3.01	2003-07-22
31	1K9M\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3	2002-07-19
32	1VQ5\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, 5'-D((DC)P(DC)P(5AA)P(2OP)P(PO2)PAPCC)-3')	Haloarcula marismortui	Archaea	RF02540	The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui	X-ray diffraction	2.6	2005-11-29
33	3OW2\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit	X-ray diffraction	2.7	2012-06-20
34	3CCL\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.	X-ray diffraction	2.9	2008-05-20
35	3CMA\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, RNA (5'-R(CPCP*(8AN))-3')	Haloarcula marismortui	Archaea	RF02540	The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.8	2008-09-23
36	1YIT\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.8	2005-04-26
37	3CCV\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A	X-ray diffraction	2.9	2008-05-20
38	3CCQ\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U	X-ray diffraction	2.9	2008-05-20
39	1YIJ\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.6	2005-04-26
40	1YJW\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	2.9	2005-04-26
41	3G71\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Bruceantin bound to the large ribosomal subunit	X-ray diffraction	2.85	2009-04-28
42	1M1K\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3.2	2002-07-19
43	1N8R\|1\|A	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Structure of large ribosomal subunit in complex with virginiamycin M	X-ray diffraction	3	2003-07-22
44	1Q86\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, CCA-phenylalanine-cariotic-acid-biotin	Haloarcula marismortui	Archaea	RF02540	Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.	X-ray diffraction	3	2003-10-07
45	1YJN\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-ray diffraction	3	2005-04-26
46	1Q82\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, CC-puromycin	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit	X-ray diffraction	2.98	2003-10-07
47	1FFK\|1\|0	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION	X-ray diffraction	2.4	2000-08-14
48	2OTL\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Girodazole bound to the large subunit of Haloarcula marismortui	X-ray diffraction	2.7	2007-04-03
49	3CD6\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin	X-ray diffraction	2.75	2008-05-20
50	1Q81\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna, minihelix-puromycin	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.	X-ray diffraction	2.95	2003-10-07
51	1K8A\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui	X-ray diffraction	3	2002-07-19
52	1YJ9\|1\|0	Large subunit ribosomal RNA	23S Ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22	X-ray diffraction	2.8	2005-04-26
53	3CCE\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A	X-ray diffraction	2.75	2008-05-20
54	1KD1\|1\|A	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui	X-ray diffraction	3	2002-07-19
55	3I55\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit	X-ray diffraction	3.11	2010-03-09
56	3I56\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit	X-ray diffraction	2.9	2010-03-09
57	1Q7Y\|1\|A	Large subunit ribosomal RNA	23S ribosomal rna	Haloarcula marismortui	Archaea	RF02540	Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit	X-ray diffraction	3.2	2003-10-07
58	1QVG\|1\|0	Large subunit ribosomal RNA	23S ribosomal rna, Oligonucleotide CCA	Haloarcula marismortui	Archaea	RF02540	Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui	X-ray diffraction	2.9	2003-11-11
59	2OTJ\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	13-deoxytedanolide bound to the large subunit of Haloarcula marismortui	X-ray diffraction	2.9	2007-04-03
60	3CCS\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A	X-ray diffraction	2.95	2008-05-20
61	2QEX\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit	X-ray diffraction	2.9	2008-09-30
62	3CME\|1\|0	Large subunit ribosomal RNA	50S RIBOSOMAL RNA, RNA (5'-R(CPCP*(8AN))-3')	Haloarcula marismortui	Archaea	RF02540	The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui	X-ray diffraction	2.95	2008-09-23
63	3CCR\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.	X-ray diffraction	3	2008-05-20
64	1W2B\|1\|0	Large subunit ribosomal RNA	23S RRNA	Haloarcula marismortui	Archaea	RF02540	Trigger Factor ribosome binding domain in complex with 50S	X-ray diffraction	3.5	2004-09-02
65	3CCJ\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U	X-ray diffraction	3.3	2008-05-20
66	2QA4\|1\|0	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit	X-ray diffraction	3	2008-04-01
67	3G4S\|1\|0	Large subunit ribosomal RNA	23S ribosomal RNA	Haloarcula marismortui	Archaea	RF02540	Co-crystal structure of Tiamulin bound to the large ribosomal subunit	X-ray diffraction	3.2	2009-04-28
68	1FG0\|1\|A	Large subunit ribosomal RNA	23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'	Haloarcula marismortui	Archaea	RF02540	LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND	X-ray diffraction	3	2000-08-28
69	1FFZ\|1\|A	Large subunit ribosomal RNA	23S RIBOSOMAL RNA	Haloarcula marismortui	Archaea	RF02540	LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN	X-ray diffraction	3.2	2000-08-28

Release history

Release	2.0	3.0	4.0	5.0
Date	2014-12-05	2016-07-25	2016-07-25	2016-07-25

Parents

This class	Parent classes	Release id	Intersection	Added to this class	Only in parent

Children

This class	Descendant classes	Release id	Intersection	Only in this class	Added to child
NR_4.0_65634.1	NR_4.0_10718.1	6.0	(8) 1VQ6\|1\|0, 1VQN\|1\|0, 1S72\|1\|0, 4V9F\|1\|0, 1VQM\|1\|0, 3CMA\|1\|0, 1QVF\|1\|0, 1VQL\|1\|0	(61) 3CC7\|1\|0, 3G71\|1\|0, 1K9M\|1\|A, 2QEX\|1\|0, 1VQ8\|1\|0, 1N8R\|1\|A, 3CXC\|1\|0, 1JJ2\|1\|0, 2OTJ\|1\|0, 1VQ4\|1\|0, 1KQS\|1\|0, 3CD6\|1\|0, 1VQO\|1\|0, 1YJW\|1\|0, 3CCV\|1\|0, 3OW2\|1\|0, 1YIT\|1\|0, 1Q81\|1\|A, 1K8A\|1\|A, 3CCR\|1\|0, 1VQ7\|1\|0, 1YHQ\|1\|0, 1FG0\|1\|A, 3CCL\|1\|0, 1QVG\|1\|0, 3CCJ\|1\|0, 3I56\|1\|0, 1KD1\|1\|A, 3CC4\|1\|0, 1VQK\|1\|0, 1Q7Y\|1\|A, 3G6E\|1\|0, 2QA4\|1\|0, 1M90\|1\|A, 3CPW\|1\|0, 1W2B\|1\|0, 2OTL\|1\|0, 3CME\|1\|0, 1FFZ\|1\|A, 1YJN\|1\|0, 1Q86\|1\|A, 1KC8\|1\|A, 3CCU\|1\|0, 1YIJ\|1\|0, 1K73\|1\|A, 3CCQ\|1\|0, 1VQ5\|1\|0, 3G4S\|1\|0, 1VQP\|1\|0, 1M1K\|1\|A, 3CCM\|1\|0, 1FFK\|1\|0, 3CCE\|1\|0, 1Q82\|1\|A, 3I55\|1\|0, 1VQ9\|1\|0, 3CC2\|1\|0, 1NJI\|1\|A, 1YI2\|1\|0, 1YJ9\|1\|0, 3CCS\|1\|0	(0)

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).

#S	PDB	Title	Method	Resolution	Length
1	2QEX\|1\|0	Title: Negamycin Binds to the Wall of the Nascent Chain Exit Tunnel of the 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.9	2749
2	2QA4\|1\|0	Title: A more complete structure of the the L7/L12 stalk of the Haloarcula marismortui 50S large ribosomal subunit	X-RAY DIFFRACTION	3	2749
3	1VQ4\|1\|0	Title: The structure of the transition state analogue 'DAA' bound to the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.7	2749
4	1QVG\|1\|0	Title: Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.9	2754
5	4V9F\|1\|0	Title: The re-refined crystal structure of the Haloarcula marismortui large ribosomal subunit at 2.4 Angstrom resolution: more complete structure of the L7/L12 and L1 stalk, L5 and LX proteins	X-RAY DIFFRACTION	2.4	2803
6	1FFK\|1\|0	Title: CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION	X-RAY DIFFRACTION	2.4	2706
7	1W2B\|1\|0	Title: Trigger Factor ribosome binding domain in complex with 50S	X-RAY DIFFRACTION	3.5	2754
8	1Q7Y\|1\|A	Title: Crystal Structure of CCdAP-Puromycin bound at the Peptidyl transferase center of the 50S ribosomal subunit	X-RAY DIFFRACTION	3.2	2754
9	1Q81\|1\|A	Title: Crystal Structure of minihelix with 3' puromycin bound to A-site of the 50S ribosomal subunit.	X-RAY DIFFRACTION	2.95	2754
10	1Q82\|1\|A	Title: Crystal Structure of CC-Puromycin bound to the A-site of the 50S ribosomal subunit	X-RAY DIFFRACTION	2.98	2754
11	1KC8\|1\|A	Title: Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit	X-RAY DIFFRACTION	3.01	2754
12	1N8R\|1\|A	Title: Structure of large ribosomal subunit in complex with virginiamycin M	X-RAY DIFFRACTION	3	2754
13	1K8A\|1\|A	Title: Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
14	1KD1\|1\|A	Title: Co-crystal Structure of Spiramycin bound to the 50S Ribosomal Subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
15	1K9M\|1\|A	Title: Co-crystal structure of tylosin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3	2754
16	1M1K\|1\|A	Title: Co-crystal structure of azithromycin bound to the 50S ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3.2	2754
17	1QVF\|1\|0	Title: Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	3.1	2754
18	1K73\|1\|A	Title: Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-RAY DIFFRACTION	3.01	2754
19	1JJ2\|1\|0	Title: Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution	X-RAY DIFFRACTION	2.4	2754
20	1S72\|1\|0	Title: REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION	X-RAY DIFFRACTION	2.4	2749
21	1NJI\|1\|A	Title: Structure of chloramphenicol bound to the 50S ribosomal subunit	X-RAY DIFFRACTION	3	2754
22	1M90\|1\|A	Title: Co-crystal structure of CCA-Phe-caproic acid-biotin and sparsomycin bound to the 50S ribosomal subunit	X-RAY DIFFRACTION	2.8	2754
23	3CXC\|1\|0	Title: The structure of an enhanced oxazolidinone inhibitor bound to the 50S ribosomal subunit of H. marismortui	X-RAY DIFFRACTION	3	2754
24	1VQ5\|1\|0	Title: The structure of the transition state analogue 'RAA' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.6	2749
25	1VQ7\|1\|0	Title: The structure of the transition state analogue 'DCA' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.5	2749
26	1VQ6\|1\|0	Title: The structure of c-hpmn and CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.7	2749
27	1Q86\|1\|A	Title: Crystal structure of CCA-Phe-cap-biotin bound simultaneously at half occupancy to both the A-site and P-site of the the 50S ribosomal Subunit.	X-RAY DIFFRACTION	3	2754
28	2OTL\|1\|0	Title: Girodazole bound to the large subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.7	2749
29	1YJ9\|1\|0	Title: Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22	X-RAY DIFFRACTION	2.8	2750
30	3I56\|1\|0	Title: Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit	X-RAY DIFFRACTION	2.9	2749
31	1YJN\|1\|0	Title: Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	3	2749
32	1YIT\|1\|0	Title: Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.8	2749
33	1YJW\|1\|0	Title: Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.9	2749
34	1YIJ\|1\|0	Title: Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.6	2749
35	1YI2\|1\|0	Title: Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.65	2749
36	3CC2\|1\|0	Title: The Refined Crystal Structure of the Haloarcula Marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution with rrnA Sequence for the 23S rRNA and Genome-derived Sequences for r-Proteins	X-RAY DIFFRACTION	2.4	2749
37	1YHQ\|1\|0	Title: Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui	X-RAY DIFFRACTION	2.4	2749
38	3G6E\|1\|0	Title: Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit	X-RAY DIFFRACTION	2.7	2749
39	3G71\|1\|0	Title: Co-crystal structure of Bruceantin bound to the large ribosomal subunit	X-RAY DIFFRACTION	2.85	2749
40	2OTJ\|1\|0	Title: 13-deoxytedanolide bound to the large subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.9	2749
41	3CC4\|1\|0	Title: Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.7	2749
42	3CCV\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2616A	X-RAY DIFFRACTION	2.9	2749
43	3CCU\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482C	X-RAY DIFFRACTION	2.8	2749
44	3CCE\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535A	X-RAY DIFFRACTION	2.75	2749
45	3CC7\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2487U	X-RAY DIFFRACTION	2.7	2749
46	3CCQ\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488U	X-RAY DIFFRACTION	2.9	2749
47	3CCL\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation U2535C. Density for Anisomycin is visible but not included in model.	X-RAY DIFFRACTION	2.9	2749
48	3CD6\|1\|0	Title: Co-cystal of large Ribosomal Subunit mutant G2616A with CC-Puromycin	X-RAY DIFFRACTION	2.75	2749
49	3CCS\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2482A	X-RAY DIFFRACTION	2.95	2749
50	3CCR\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation A2488C. Density for anisomycin is visible but not included in the model.	X-RAY DIFFRACTION	3	2749
51	3I55\|1\|0	Title: Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit	X-RAY DIFFRACTION	3.11	2749
52	3G4S\|1\|0	Title: Co-crystal structure of Tiamulin bound to the large ribosomal subunit	X-RAY DIFFRACTION	3.2	2749
53	3CCJ\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation C2534U	X-RAY DIFFRACTION	3.3	2749
54	3CCM\|1\|0	Title: Structure of Anisomycin resistant 50S Ribosomal Subunit: 23S rRNA mutation G2611U	X-RAY DIFFRACTION	2.55	2749
55	1VQO\|1\|0	Title: The structure of CCPMN bound to the large ribosomal subunit haloarcula marismortui	X-RAY DIFFRACTION	2.2	2749
56	1VQK\|1\|0	Title: The structure of CCDA-PHE-CAP-BIO bound to the a site of the ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2749
57	1VQN\|1\|0	Title: The structure of CC-HPMN AND CCA-PHE-CAP-BIO bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.4	2749
58	1VQM\|1\|0	Title: The structure of the transition state analogue 'DAN' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2749
59	1VQL\|1\|0	Title: The structure of the transition state analogue 'DCSN' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.3	2749
60	1VQP\|1\|0	Title: The structure of the transition state analogue 'RAP' bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.25	2749
61	1VQ8\|1\|0	Title: The structure of CCDA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.2	2749
62	1VQ9\|1\|0	Title: The structure of CCA-PHE-CAP-BIO and the antibiotic sparsomycin bound to the large ribosomal subunit of haloarcula marismortui	X-RAY DIFFRACTION	2.4	2749
63	3CMA\|1\|0	Title: The structure of CCA and CCA-Phe-Cap-Bio bound to the large ribosomal subunit of Haloarcula marismortui	X-RAY DIFFRACTION	2.8	2749
64	3CME\|1\|0	Title: The Structure of CA and CCA-PHE-CAP-BIO Bound to the Large Ribosomal Subunit of Haloarcula Marismortui	X-RAY DIFFRACTION	2.95	2749
65	3OW2\|1\|0	Title: Crystal Structure of Enhanced Macrolide Bound to 50S Ribosomal Subunit	X-RAY DIFFRACTION	2.7	2754
66	3CPW\|1\|0	Title: The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI	X-RAY DIFFRACTION	2.7	2754
67	1KQS\|1\|0	Title: The Haloarcula marismortui 50S Complexed with a Pretranslocational Intermediate in Protein Synthesis	X-RAY DIFFRACTION	3.1	2754
68	1FG0\|1\|A	Title: LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND	X-RAY DIFFRACTION	3	496
69	1FFZ\|1\|A	Title: LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN	X-RAY DIFFRACTION	3.2	496

Coloring options: Nucleotide numbers

Equivalence class NR_4.0_65634.1 Obsolete

Release history

Parents

Children