Equivalence class NR_all_98024.1 Obsolete
# | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
---|---|---|---|---|---|---|---|---|---|---|
1 | 1QWA|1|A (rep) | 18S ribosomal RNA, 5'ETS | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Solution NMR | 2003-11-25 | |||||
2 | 1RKJ|1|B | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3' | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | Solution NMR | 2004-04-27 |
Parents
This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
---|
Children
This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
---|---|---|---|---|---|
NR_all_98024.1 | NR_all_53701.1 | 5.0 | (1) 1RKJ|1|B | (1) 1QWA|1|A | (0) |
NR_all_98024.1 | NR_all_61503.1 | 5.0 | (1) 1QWA|1|A | (1) 1RKJ|1|B | (0) |
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).#S | PDB | Title | Method | Resolution | Length | NAKB_NA_annotation | NAKB_protein_annotation |
---|---|---|---|---|---|---|---|
1 | 1QWA|1|A | Title: NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | SOLUTION NMR | 21 | |||
2 | 1RKJ|1|B | Title: Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | SOLUTION NMR | 21 |
Coloring options: