Equivalence class NR_all_41510.1 Current
# | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
---|---|---|---|---|---|---|---|---|---|---|
1 | 5T7B|1|R (rep) | RNA (UVP)UAUAGAGCAAGAACACUGUU | Mus musculus | Eukarya | Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex | X-ray diffraction | 2.53 | 2016-12-14 |
Release history
Release | 8.0 | 9.0 | 9.1 | 9.2 | 9.3 | 9.4 | 9.5 | 9.6 | 9.7 | 9.8 | 9.9 | 9.10 | 9.11 | 9.12 | 9.13 | 9.14 | 9.15 | 9.16 | 9.17 | 9.18 | 9.19 | 9.20 | 9.21 | 9.22 | 9.23 | 9.24 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Date | 2017-04-05 | 2017-10-26 | 2017-11-07 | 2017-12-02 | 2017-12-13 | 2017-12-21 | 2017-12-22 | 2018-01-04 | 2018-01-05 | 2018-01-10 | 2018-01-11 | 2018-01-12 | 2018-01-28 | 2018-04-01 | 2018-04-01 | 2018-09-14 | 2018-11-09 | 2018-11-16 | 2018-11-23 | 2018-11-30 | 2018-12-05 | 2018-12-12 | 2018-12-19 | 2018-12-26 | 2019-01-02 | 2019-01-09 |
Parents
This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
---|
Children
This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).#S | PDB | Title | Method | Resolution | Length | NAKB_NA_annotation | NAKB_protein_annotation |
---|---|---|---|---|---|---|---|
1 | 5T7B|1|R | Title: Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex | X-RAY DIFFRACTION | 2.53 | 10 |
Coloring options: