Equivalence class DNA_4.0_62371.1 Current
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 3MVD|1|I+ 3MVD|1|J (rep) | DNA (146-MER) | Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particle | X-ray diffraction | 2.9 | 2010-08-25 | ||||
| 2 | 2PYO|1|I+ 2PYO|1|J | DNA (147-MER) | Homo sapiens | Drosophila nucleosome core | X-ray diffraction | 2.43 | 2007-11-06 | |||
| 3 | 3MGR|1|I+ 3MGR|1|J | DNA (147-MER) | Binding of Rubidium ions to the Nucleosome Core Particle | X-ray diffraction | 2.3 | 2010-06-16 | ||||
| 4 | 3LJA|1|I+ 3LJA|1|J | 147mer DNA | Using Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the Nucleosome | X-ray diffraction | 2.75 | 2010-04-14 | ||||
| 5 | 3MGP|1|I+ 3MGP|1|J | DNA (147-MER) | Binding of Cobalt ions to the Nucleosome Core Particle | X-ray diffraction | 2.44 | 2010-06-16 | ||||
| 6 | 3MGQ|1|I+ 3MGQ|1|J | DNA (147-MER) | Binding of Nickel ions to the Nucleosome Core Particle | X-ray diffraction | 2.65 | 2010-06-16 | ||||
| 7 | 3MGS|1|I+ 3MGS|1|J | DNA (147-MER) | Binding of Cesium ions to the Nucleosome Core particle | X-ray diffraction | 3.15 | 2010-06-16 | ||||
| 8 | 3LEL|1|I+ 3LEL|1|J | 147-MER DNA | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-ray diffraction | 2.95 | 2010-05-19 | ||||
| 9 | 3LEL|1|S+ 3LEL|1|T | 147-MER DNA | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-ray diffraction | 2.95 | 2010-05-19 | ||||
| 10 | 2FJ7|1|I+ 2FJ7|1|J | 147 bp DNA containing 16 bp poly dA element, 147 bp DNA containing 16 bp poly dT element | Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | X-ray diffraction | 3.2 | 2006-09-26 | ||||
| 11 | 3B6F|1|I+ 3B6F|1|J | 147-MER DNA | Homo sapiens | Nucleosome core particle treated with cisplatin | X-ray diffraction | 3.45 | 2007-12-25 | |||
| 12 | 3B6G|1|I+ 3B6G|1|J | 147-MER DNA | Homo sapiens | Nucleosome core particle treated with oxaliplatin | X-ray diffraction | 3.45 | 2007-12-25 | |||
| 13 | 1KX5|1|I+ 1KX5|1|J | DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') | Homo sapiens | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | X-ray diffraction | 1.94 | 2002-12-25 |
Release history
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).| #S | PDB | Title | Method | Resolution | Length | NAKB_NA_annotation | NAKB_protein_annotation |
|---|---|---|---|---|---|---|---|
| 1 | 3MGQ|1|I+3MGQ|1|J | Binding of Nickel ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.65 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 2 | 3MGP|1|I+3MGP|1|J | Binding of Cobalt ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.44 | 147 | chromatin,nucleosome,structural | |
| 3 | 3LEL|1|I+3LEL|1|J | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-RAY DIFFRACTION | 2.95 | 147 | double helix,structure | chromatin,nucleosome,structural |
| 4 | 3LEL|1|S+3LEL|1|T | Structural Insight into the Sequence-Dependence of Nucleosome Positioning | X-RAY DIFFRACTION | 2.95 | 147 | double helix,structure | chromatin,nucleosome,structural |
| 5 | 1KX5|1|I+1KX5|1|J | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | X-RAY DIFFRACTION | 1.94 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 6 | 2PYO|1|I+2PYO|1|J | Drosophila nucleosome core | X-RAY DIFFRACTION | 2.43 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 7 | 3MGR|1|I+3MGR|1|J | Binding of Rubidium ions to the Nucleosome Core Particle | X-RAY DIFFRACTION | 2.3 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 8 | 3MGS|1|I+3MGS|1|J | Binding of Cesium ions to the Nucleosome Core particle | X-RAY DIFFRACTION | 3.15 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 9 | 3LJA|1|I+3LJA|1|J | Using Soft X-Rays for a Detailed Picture of Divalent Metal Binding in the Nucleosome | X-RAY DIFFRACTION | 2.75 | 147 | B-form double helix,double helix,structure | chromatin,nucleosome,structural |
| 10 | 3B6G|1|I+3B6G|1|J | Nucleosome core particle treated with oxaliplatin | X-RAY DIFFRACTION | 3.45 | 147 | double helix,structure | chromatin,nucleosome,structural |
| 11 | 3B6F|1|I+3B6F|1|J | Nucleosome core particle treated with cisplatin | X-RAY DIFFRACTION | 3.45 | 147 | chromatin,nucleosome,structural | |
| 12 | 2FJ7|1|I+2FJ7|1|J | Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | X-RAY DIFFRACTION | 3.2 | 147 | double helix,structure | chromatin,nucleosome,structural |
| 13 | 3MVD|1|I+3MVD|1|J | Crystal structure of the chromatin factor RCC1 in complex with the nucleosome core particle | X-RAY DIFFRACTION | 2.9 | 147 | B-form double helix,double helix,structure | cell cycle,chromatin,nucleosome,regulatory,structural |
Coloring options: