#IFEStandardized nameMoleculeOrganismSourceRfamTitleMethodRes. ÅDate
11SAX|1|C+ 1SAX|1|D (rep)5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3'Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNAX-ray diffraction2.82004-04-27

Release history

Release0.10.20.30.40.50.6
Date2011-02-052011-02-122011-02-162011-02-192011-02-262011-03-05

Parents

This classParent classesRelease idIntersectionAdded to this classOnly in parent

Children

This class Descendant classesRelease idIntersectionOnly in this classAdded to child

Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5

#S - ordering by similarity (same as in the heat map).
#SPDBTitleMethodResolutionLengthNAKB_NA_annotationNAKB_protein_annotation
1
1SAX|1|C+1SAX|1|D
Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNAX-RAY DIFFRACTION2.825B-form double helix,double helix,structureDNA-binding transcription factor (TF),helix-turn-helix (HTH),regulatory,transcription,winged helix/forkhead

Coloring options:

Copyright 2024 BGSU RNA group. Page generated in 0.0348 s