Equivalence class DNA_4.0_30437.1 Current
# | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
---|---|---|---|---|---|---|---|---|---|---|
1 | 1SAX|1|C+ 1SAX|1|D (rep) | 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3' | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-ray diffraction | 2.8 | 2004-04-27 |
Release history
Parents
This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
---|
Children
This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).#S | PDB | Title | Method | Resolution | Length | NAKB_NA_annotation | NAKB_protein_annotation |
---|---|---|---|---|---|---|---|
1 | 1SAX|1|C+1SAX|1|D | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-RAY DIFFRACTION | 2.8 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),helix-turn-helix (HTH),regulatory,transcription,winged helix/forkhead |
Coloring options: