Equivalence class DNA_4.0_01210.1 Current
| # | IFE | Standardized name | Molecule | Organism | Source | Rfam | Title | Method | Res. Å | Date |
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2IS6|1|C+ 2IS6|1|D (rep) | 5'-D(*CP*GP*AP*GP*CP*AP*CP*TP*GP*CP*AP*GP*TP*GP*CP*TP*CP*GP*TP*TP*GP*TP*TP*AP*T)-3' | Crystal structure of UvrD-DNA-ADPMgF3 ternary complex | X-ray diffraction | 2.2 | 2007-01-09 | ||||
| 2 | 1SL1|1|T+ 1SL1|1|P | 5'-D(*CP*CP*C*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*TP*(2DA))-3' | Binary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-ray diffraction | 2.2 | 2004-07-06 | ||||
| 3 | 1SKS|1|T+ 1SKS|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 4 | 1R7M|1|C+ 1R7M|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*AP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*TP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | The homing endonuclease I-SceI bound to its DNA recognition region | X-ray diffraction | 2.25 | 2004-10-26 | ||||
| 5 | 1R7M|1|E+ 1R7M|1|F | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*AP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*TP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | The homing endonuclease I-SceI bound to its DNA recognition region | X-ray diffraction | 2.25 | 2004-10-26 | ||||
| 6 | 1SKW|1|T+ 1SKW|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*C*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 7 | 3C0X|1|D+ 3C0X|1|B+ 3C0X|1|C | DNA (5'-D(*DC*DAP*DCP*DGP*DCP*DTP*DAP*DGP*DGP*DGP*DAP*DTP*DAP*DA)-3'), DNA (5'-D(P*DCP*DAP*DGP*DGP*DGP*DTP*DAP*DAP*DTP*DAP*DC)-3'), DNA (5'-D(*DG*DGP*DTP*DAP*DTP*DTP*DAP*DCP*DCP*DCP*DTP*DGP*DTP*DTP*DAP*DTP*DCP*DCP*DCP*DTP*DAP*DGP*DCP*DGP*DT)-3') | I-SceI in complex with a top nicked DNA substrate | X-ray diffraction | 2.3 | 2008-05-06 | ||||
| 8 | 1SL2|1|T+ 1SL2|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*TP*(2DA))-3' | Ternary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 2.3 | 2004-07-06 | ||||
| 9 | 3OOL|1|C+ 3OOL|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*CP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*GP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | I-SceI complexed with C/G+4 DNA substrate | X-ray diffraction | 2.3 | 2010-11-17 | ||||
| 10 | 3OOR|1|C+ 3OOR|1|D | 5'-D(*CP*AP*CP*GP*CP*TP*AP*GP*GP*GP*AP*TP*AP*AP*CP*CP*GP*GP*GP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*GP*TP*AP*TP*TP*AP*CP*CP*CP*GP*GP*TP*TP*AP*TP*CP*CP*CP*TP*AP*GP*CP*GP*T)-3' | I-SceI mutant (K86R/G100T)complexed with C/G+4 DNA substrate | X-ray diffraction | 2.5 | 2010-11-17 | ||||
| 11 | 2P6R|1|X+ 2P6R|1|Y | 25-MER, 5'-D(*CP*TP*AP*GP*AP*GP*AP*CP*TP*AP*TP*CP*GP*AP*T)-3' | Crystal structure of superfamily 2 helicase Hel308 in complex with unwound DNA | X-ray diffraction | 3 | 2007-06-12 | ||||
| 12 | 1ZX4|1|S+ 1ZX4|1|T | parS-small DNA centromere site | Structure of ParB bound to DNA | X-ray diffraction | 2.98 | 2005-11-29 | ||||
| 13 | 2O93|1|A+ 2O93|1|B | kappaB enhancer element, DNA 25-mer | Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element | X-ray diffraction | 3.05 | 2007-06-19 | ||||
| 14 | 2V6E|1|C+ 2V6E|1|E+ 2V6E|1|D+ 2V6E|1|F | TELRL | Escherichia virus N15 | protelomerase TelK complexed with substrate DNA | X-ray diffraction | 3.2 | 2007-10-02 | |||
| 15 | 1SL0|1|T+ 1SL0|1|P | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 3.2 | 2004-07-06 | ||||
| 16 | 1SL0|1|U+ 1SL0|1|Q | 5'-D(*CP*CP*CP*(TTD)P*AP*GP*GP*CP*AP*CP*TP*GP*GP*CP*CP*GP*TP*CP*GP*TP*TP*TP*TP*CP*G)-3', 5'-D(*CP*GP*AP*AP*AP*AP*CP*GP*AP*CP*GP*GP*CP*CP*AP*GP*TP*GP*CP*CP*(2DT))-3' | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-ray diffraction | 3.2 | 2004-07-06 | ||||
| 17 | 1AU7|1|C+ 1AU7|1|D | CONSENSUS DNA 25-MER, DNA (5'-D(*CP*TP*TP*CP*CP*TP*CP*AP*TP*GP*TP*AP*TP*AP*TP*AP*C P*AP*TP*GP*AP*GP* GP*A)-3') | PIT-1 MUTANT/DNA COMPLEX | X-ray diffraction | 2.3 | 1998-01-28 | ||||
| 18 | 1SAX|1|C+ 1SAX|1|D | 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', 5'-d(CAAAATTACAACTGTAATATCGGAG)-3' | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-ray diffraction | 2.8 | 2004-04-27 | ||||
| 19 | 1Z63|1|C+ 1Z63|1|D | 5'-D(*AP*AP*AP*AP*AP*A*AP*TP*TP*GP*CP*CP*GP*AP*AP*GP*AP*CP*GP*AP*AP*AP*AP*AP*A)-3', 5'-D(*TP*TP*TP*TP*TP*TP*TP*CP*GP*TP*CP*TP*TP*CP*GP*GP*CP*AP*AP*TP*TP*TP*TP*TP*T)-3' | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-ray diffraction | 3 | 2005-05-17 | ||||
| 20 | 1Z63|1|E+ 1Z63|1|F | 5'-D(*AP*AP*AP*AP*AP*A*AP*TP*TP*GP*CP*CP*GP*AP*AP*GP*AP*CP*GP*AP*AP*AP*AP*AP*A)-3', 5'-D(*TP*TP*TP*TP*TP*TP*TP*CP*GP*TP*CP*TP*TP*CP*GP*GP*CP*AP*AP*TP*TP*TP*TP*TP*T)-3' | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-ray diffraction | 3 | 2005-05-17 |
Release history
Parents
| This class | Parent classes | Release id | Intersection | Added to this class | Only in parent |
|---|
Children
| This class | Descendant classes | Release id | Intersection | Only in this class | Added to child |
|---|
Heat map of mutual geometric discrepancy, in Angstroms per nucleotide. Instances are ordered to put similar structures near each other. The colorbar ranges from 0 to the maximum observed discrepancy, up to 0.5
#S - ordering by similarity (same as in the heat map).| #S | PDB | Title | Method | Resolution | Length | NAKB_NA_annotation | NAKB_protein_annotation |
|---|---|---|---|---|---|---|---|
| 1 | 2IS6|1|C+2IS6|1|D | Crystal structure of UvrD-DNA-ADPMgF3 ternary complex | X-RAY DIFFRACTION | 2.2 | 25 | enzyme,helicase,hydrolase | |
| 2 | 1SKW|1|T+1SKW|1|P | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.3 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 3 | 1SL0|1|T+1SL0|1|P | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 3.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 4 | 1SL0|1|U+1SL0|1|Q | Ternary 3' complex of T7 DNA polymerase with a DNA primer/template containing a disordered cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 3.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 5 | 2O93|1|A+2O93|1|B | Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element | X-RAY DIFFRACTION | 3.05 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),immunoglobulin (Ig) fold,regulatory,rel homology,transcription |
| 6 | 2V6E|1|C+2V6E|1|E+2V6E|1|D+2V6E|1|F | protelomerase TelK complexed with substrate DNA | X-RAY DIFFRACTION | 3.2 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase |
| 7 | 1SAX|1|C+1SAX|1|D | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | X-RAY DIFFRACTION | 2.8 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),helix-turn-helix (HTH),regulatory,transcription,winged helix/forkhead |
| 8 | 1Z63|1|E+1Z63|1|F | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-RAY DIFFRACTION | 3 | 25 | B-form double helix,double helix,structure | enzyme,helicase,hydrolase |
| 9 | 1SL2|1|T+1SL2|1|P | Ternary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template and an incoming nucleotide | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 10 | 1Z63|1|C+1Z63|1|D | Sulfolobus solfataricus SWI2/SNF2 ATPase core in complex with dsDNA | X-RAY DIFFRACTION | 3 | 25 | B-form double helix,double helix,structure | enzyme,helicase,hydrolase |
| 11 | 1ZX4|1|S+1ZX4|1|T | Structure of ParB bound to DNA | X-RAY DIFFRACTION | 2.98 | 25 | B-form double helix,double helix,structure | centromere,chromatin,structural |
| 12 | 1AU7|1|C+1AU7|1|D | PIT-1 MUTANT/DNA COMPLEX | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | DNA-binding transcription factor (TF),helix-turn-helix (HTH),homeodomain,regulatory,transcription |
| 13 | 3C0X|1|D+3C0X|1|B+3C0X|1|C | I-SceI in complex with a top nicked DNA substrate | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease |
| 14 | 1R7M|1|E+1R7M|1|F | The homing endonuclease I-SceI bound to its DNA recognition region | X-RAY DIFFRACTION | 2.25 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease |
| 15 | 3OOR|1|C+3OOR|1|D | I-SceI mutant (K86R/G100T)complexed with C/G+4 DNA substrate | X-RAY DIFFRACTION | 2.5 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease |
| 16 | 3OOL|1|C+3OOL|1|D | I-SceI complexed with C/G+4 DNA substrate | X-RAY DIFFRACTION | 2.3 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease |
| 17 | 1R7M|1|C+1R7M|1|D | The homing endonuclease I-SceI bound to its DNA recognition region | X-RAY DIFFRACTION | 2.25 | 25 | B-form double helix,double helix,structure | enzyme,hydrolase,nuclease |
| 18 | 1SKS|1|T+1SKS|1|P | Binary 3' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.3 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 19 | 1SL1|1|T+1SL1|1|P | Binary 5' complex of T7 DNA polymerase with a DNA primer/template containing a cis-syn thymine dimer on the template | X-RAY DIFFRACTION | 2.2 | 25 | double helix,structure | enzyme,oxidoreductase,polymerase,transferase |
| 20 | 2P6R|1|X+2P6R|1|Y | Crystal structure of superfamily 2 helicase Hel308 in complex with unwound DNA | X-RAY DIFFRACTION | 3 | 25 | enzyme,helicase,hydrolase |
Coloring options: